Text Generation
Transformers
Safetensors
Upper Grand Valley Dani
llama
genomic
speculative-decoding
text-generation-inference
Instructions to use HuggingFaceBio/Carbon-500M with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use HuggingFaceBio/Carbon-500M with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("text-generation", model="HuggingFaceBio/Carbon-500M")# Load model directly from transformers import AutoTokenizer, AutoModelForCausalLM tokenizer = AutoTokenizer.from_pretrained("HuggingFaceBio/Carbon-500M") model = AutoModelForCausalLM.from_pretrained("HuggingFaceBio/Carbon-500M", device_map="auto") - Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- vLLM
How to use HuggingFaceBio/Carbon-500M with vLLM:
Install from pip and serve model
# Install vLLM from pip: pip install vllm # Start the vLLM server: vllm serve "HuggingFaceBio/Carbon-500M" # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:8000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "HuggingFaceBio/Carbon-500M", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker
docker model run hf.co/HuggingFaceBio/Carbon-500M
- SGLang
How to use HuggingFaceBio/Carbon-500M with SGLang:
Install from pip and serve model
# Install SGLang from pip: pip install sglang # Start the SGLang server: python3 -m sglang.launch_server \ --model-path "HuggingFaceBio/Carbon-500M" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "HuggingFaceBio/Carbon-500M", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker images
docker run --gpus all \ --shm-size 32g \ -p 30000:30000 \ -v ~/.cache/huggingface:/root/.cache/huggingface \ --env "HF_TOKEN=<secret>" \ --ipc=host \ lmsysorg/sglang:latest \ python3 -m sglang.launch_server \ --model-path "HuggingFaceBio/Carbon-500M" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "HuggingFaceBio/Carbon-500M", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }' - Docker Model Runner
How to use HuggingFaceBio/Carbon-500M with Docker Model Runner:
docker model run hf.co/HuggingFaceBio/Carbon-500M
Update README.md
Browse files
README.md
CHANGED
|
@@ -79,6 +79,78 @@ print(tok.decode(out[0][inputs.input_ids.shape[1]:], skip_special_tokens=True))
|
|
| 79 |
|
| 80 |
Output is guaranteed identical to greedy decoding with the target model alone; only wall-clock latency is reduced.
|
| 81 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 82 |
## Evaluation
|
| 83 |
|
| 84 |
Carbon-500M is benchmarked against ≈ 1B-parameter DNA models on the standard Carbon evaluation suite. See the [Carbon-3B card](https://huggingface.co/HuggingFaceBio/Carbon-3B#evaluation) for the task definitions and methodology.
|
|
|
|
| 79 |
|
| 80 |
Output is guaranteed identical to greedy decoding with the target model alone; only wall-clock latency is reduced.
|
| 81 |
|
| 82 |
+
### Base-pair-level generation and scoring
|
| 83 |
+
|
| 84 |
+
The `fns` branch loads custom modeling code for Factorized Nucleotide Supervision (FNS). Carbon still uses its efficient 6-mer tokenizer, but during generation each selected 6-mer is assembled from six per-position nucleotide distributions, giving base-pair-level control over decoded DNA. Use this branch when you need exact base-pair counts, per-position masks, or temperature/top-p behavior applied at the nucleotide level rather than over the 4,096-way 6-mer distribution:
|
| 85 |
+
|
| 86 |
+
```py
|
| 87 |
+
import math
|
| 88 |
+
import torch
|
| 89 |
+
from transformers import AutoModelForCausalLM, AutoTokenizer
|
| 90 |
+
|
| 91 |
+
model_id = "HuggingFaceBio/Carbon-500M"
|
| 92 |
+
revision = "fns"
|
| 93 |
+
device = "cuda"
|
| 94 |
+
|
| 95 |
+
tokenizer = AutoTokenizer.from_pretrained(model_id, revision=revision, trust_remote_code=True)
|
| 96 |
+
model = AutoModelForCausalLM.from_pretrained(
|
| 97 |
+
model_id,
|
| 98 |
+
revision=revision,
|
| 99 |
+
trust_remote_code=True,
|
| 100 |
+
dtype=torch.bfloat16,
|
| 101 |
+
).to(device).eval()
|
| 102 |
+
|
| 103 |
+
context = "ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG"
|
| 104 |
+
n_bp = 60
|
| 105 |
+
|
| 106 |
+
inputs = tokenizer(f"<dna>{context}", return_tensors="pt", add_special_tokens=False).to(device)
|
| 107 |
+
|
| 108 |
+
with torch.no_grad():
|
| 109 |
+
output_ids = model.generate(
|
| 110 |
+
**inputs,
|
| 111 |
+
max_new_tokens=math.ceil(n_bp / tokenizer.k),
|
| 112 |
+
do_sample=False,
|
| 113 |
+
pad_token_id=tokenizer.eos_token_id,
|
| 114 |
+
)
|
| 115 |
+
|
| 116 |
+
generated_ids = output_ids[0, inputs.input_ids.shape[1]:]
|
| 117 |
+
generated_dna = tokenizer.decode(generated_ids, skip_special_tokens=True)[:n_bp]
|
| 118 |
+
|
| 119 |
+
print(generated_dna)
|
| 120 |
+
```
|
| 121 |
+
|
| 122 |
+
The same per-base marginals are exposed through `score_sequence()`, which returns the probability assigned to the observed base at each position. Taking the mean log probability gives a base-pair-level sequence score, where higher values indicate higher model likelihood:
|
| 123 |
+
|
| 124 |
+
```py
|
| 125 |
+
import torch
|
| 126 |
+
from transformers import AutoModelForCausalLM, AutoTokenizer
|
| 127 |
+
|
| 128 |
+
model_id = "HuggingFaceBio/Carbon-500M"
|
| 129 |
+
revision = "fns"
|
| 130 |
+
device = "cuda"
|
| 131 |
+
|
| 132 |
+
tokenizer = AutoTokenizer.from_pretrained(model_id, revision=revision, trust_remote_code=True)
|
| 133 |
+
model = AutoModelForCausalLM.from_pretrained(
|
| 134 |
+
model_id,
|
| 135 |
+
revision=revision,
|
| 136 |
+
trust_remote_code=True,
|
| 137 |
+
dtype=torch.bfloat16,
|
| 138 |
+
).to(device).eval()
|
| 139 |
+
|
| 140 |
+
reference = "GGGCTATAAAGGCCATCGATCGATCGATCGATCGATCGATCG"
|
| 141 |
+
perturbed = "GGGCGCGCGCGGCCATCGATCGATCGATCGATCGATCGATCG"
|
| 142 |
+
|
| 143 |
+
with torch.no_grad():
|
| 144 |
+
bp_probs, actual_probs = model.score_sequence([reference, perturbed])
|
| 145 |
+
|
| 146 |
+
scores = [torch.log(p.clamp_min(1e-12)).mean().item() for p in actual_probs]
|
| 147 |
+
|
| 148 |
+
print(f"reference mean bp logp: {scores[0]:.4f}")
|
| 149 |
+
print(f"perturbed mean bp logp: {scores[1]:.4f}")
|
| 150 |
+
print(f"reference preferred: {scores[0] > scores[1]}")
|
| 151 |
+
```
|
| 152 |
+
|
| 153 |
+
|
| 154 |
## Evaluation
|
| 155 |
|
| 156 |
Carbon-500M is benchmarked against ≈ 1B-parameter DNA models on the standard Carbon evaluation suite. See the [Carbon-3B card](https://huggingface.co/HuggingFaceBio/Carbon-3B#evaluation) for the task definitions and methodology.
|